Lecture 2 - Input, conditionals and branching¶

Today:

Conditional control flow:
- If statements
- Else
- Elif
- Pass

Warm up¶

Raise the first element of the list below to the power of the fifth element¶

Is this number greater than 8 to the power of 10?¶

Append the answer to the end of the list¶

In [95]:

warm_up_list = [4,2,9,4,5,1]

In [96]:

# your code here
answer = warm_up_list[0] ** warm_up_list[4]
print(answer)

You can extract multiple parts of a list using a colon in your bracket `[:]`¶

For example, to extract the 1st through 3rd element of a list:¶

`my_list[0:2]`¶

In [61]:

# extract elements 2 through 4 of warm_up_list
print(warm_up_list[1:3])

[254, 324]

In python, strings are just a list of characters so this works on strings as well!¶

In [66]:

my_big_string = 'heresabigstringwithnospaces'
print(my_big_string[5:15])

abigstring

Print the 2nd through 10th states below¶

In [108]:

states = [ 'AK', 'AL', 'AR', 'AZ', 'CA', 'CO', 'CT', 'DC', 'DE', 'FL', 'GA','HI', 'IA', 'ID', 'IL', 'IN', 'KS', 'KY', 'LA', 'MA', 'MD', 'ME','MI', 'MN', 'MO', 'MS', 'MT', 'NC', 'ND', 'NE', 'NH', 'NJ', 'NM','NV', 'NY', 'OH', 'OK', 'OR', 'PA', 'RI', 'SC', 'SD', 'TN', 'TX','UT', 'VA', 'VT', 'WA', 'WI', 'WV', 'WY']
# your code here

In [109]:

print(states[1:9])

['AL', 'AR', 'AZ', 'CA', 'CO', 'CT', 'DC', 'DE']

`len()` gives you the length of a list or string¶

In [50]:

my_list = [1,33,2,23,2,32,42]
print(len(my_list))

How long are the variables below?¶

In [110]:

my_list = ['s','c','i','e','n','c','e']
my_string = 'helpiforgottoputwhitespaceinthissentence'
# your code here

In [111]:

print(len(my_list))
print(len(my_string))

7
40

How can we talk to our python script?¶

`input()` is a function that takes a text prompt and stores it as a string¶

The only argument for `input()` is a string that you want the prompt to be¶

to save what the user inputs, just save input to a variable¶

In [2]:

your_name = input("what is your name? ")

output_statement = 'python remembered your name is: ' + your_name

print(output_statement)

what is your name? vikas
python remembered your name is: vikas

Try writing a program that takes a numerical input and prints the square of it¶

In [112]:

input_number = float(input("whats your number? "))
answer = input_number ** 2
print(answer)

whats your number? 23
529.0

What is the most basic way to teach someone to do something?¶

Only give them two choices: Do this or do that¶

What are some examples of this?¶

If they don't have bananas at the grocery store, buy apples

Python thinks similarly: if the condition is true, do this thing¶

If statement structure¶

Python is sensitive to "whitespace"¶

Whitespace is a tab, or a space¶

if <yourcondition>: 
    dothis()

where `yourcondition` is anything that returns a boolean (True/False)¶

In [3]:

if 2 > 1: 
    print('Math works')
# there is an invisible tab character on the second line

Math works

Debugging practice¶

what happened here?¶

In [6]:

if 2 > 1
    print('Math works')

  Input In [6]
    if 2 > 1
            ^
SyntaxError: invalid syntax

In [7]:

if 2 > 1: 
print('Math works')

  Input In [7]
    print('Math works')
    ^
IndentationError: expected an indented block

In [11]:

if 2 > 1: 
    print('Math works')
   print('But python doesnt sometimes')

  File <tokenize>:3
    print('But python doesnt sometimes')
    ^
IndentationError: unindent does not match any outer indentation level

Does python think dogs are better than cats? whats going on??¶

In [2]:

if "dogs" > "cats":
    print("Dogs really are the best")

Dogs really are the best

strings are sorted lexicographically (aka: alphabetically) in python¶

d comes after c, which means d > c according to python¶

Write an if statement that checks if a is greater than b¶

If it is true, print "a is greater than b"¶

In [86]:

a = 100 ** 2
b = 7 ** 4

# your code here
if a > b: 
    print('a is greater than b')

a is greater than b

Else¶

Else is like saying 'otherwise' after if: "if this is true, do this. Otherwise, do that"

The general structure of an if/else statement is:¶

if <your condition>:
  dothis()
else:
  dothat()

Else does not take a conditional! it assumes the opposite of the if conditional¶

Lets try an else statement¶

In [22]:

if 'unix' < 'gui': 
    print('This sounds wrong')
else: 
    print('Roman told you so')

Roman told you so

in this case, "u" is lexicographically (alphabetically) after "g"¶

to python, this means "unix" is less than "gui" is False¶

Debugging practice¶

What went wrong here?¶

In [25]:

if 1 < 5: 
    print('5 is greater than 1')
else 1 > 5: 
    print('1 is greater than 5?? ')

  Input In [25]
    else 1 > 5:
         ^
SyntaxError: invalid syntax

In [32]:

if 1 < 5: 
    print('5 is greater than 1')
 else: 
    print('1 is greater than 5?? ')

  File <tokenize>:3
    else:
    ^
IndentationError: unindent does not match any outer indentation level

Write an if statement that checks if a is greater than b¶

if it is true, print a is greater than b¶

if it is false, print b is greater than a¶

In [97]:

a = 500 * 20
b = 7 ** 9

In [99]:

# your code here
if a > b: 
    print('a is greater than b')
else:
    print('b is greater than a')

b is greater than a

Else and elif¶

Elif is the partner of if and else:

In [87]:

# If, else and elif

x = float(input("What's your favorite number? : "))

if x == 7:
  print("We have the same favorite number!")
elif x < 2:
  print("Your favorite number is way less than mine")
elif x < 7:
  print("Your favorite number is less than mine")
else:
  print("Your favorite number is greater than mine")

What's your favorite number? : 10
Your favorite number is greater than mine

Write a program that take a number as an input and checks if it is between 28 and 30.¶

If it is less than 28, print "your number less than 28".¶

If it is greater than 30, print "your number is greater than 30".¶

If the number is 29, print "thats a nice number"¶

In [94]:

# your code here
x = float(input("What's your favorite number? : "))
if x < 28: 
    print('your number is less than 28')
elif x > 30: 
    print('your number is greater than 30')
elif x == 29:
    print('thats a nice number')

What's your favorite number? : 100
your number is greater than 30

for loops are similar between bash and python¶

Recall what a for loop is:¶

for this thing in my list of stuff, do this¶

for i in 1 2 3 4
do
   echo loop iteration $i 
done

for loop structure in python¶

for <variable> in <list>: 
    <run_command>

note that there is no do/done/semicolon!¶

In [101]:

teachers = ['Roman','Vikas','Sarah','Daniel']
for person in teachers: 
    print(person + " is a great teacher!")

Roman is a great teacher!
Vikas is a great teacher!
Sarah is a great teacher!
Daniel is a great teacher!

Write a for loop to print each letter in the first five letters of the alphabet¶

In [26]:

# your code here
alphabet = ['a','b','c','d','e']
for letter in alphabet: 
    print(letter)

a
b
c
d
e

Challenge:¶

What would the last line of the following code return?¶

my_list = [1,2,3,4,5]
i = 1
for number in my_list: 
    i = i + number
    print(i)

In [31]:

my_list = [1,2,3,4,5]
i = 1
for number in my_list: 
    i = i + number
    print(i)

Making lists quickly¶

Python has a function `range()` that will give you the numbers between the two arguments, excluding the last number¶

range(1,5) will return a sequence containing all numbers between 1 and 5

In [57]:

for num in range(1,5):
    print(num)

Write a function that sums all of the numbers between 1 and 100¶

In [31]:

# your code here
x = 0
for num in range(1,101):
    x = x + num
print(x)

Can we write a function that prints the sums of all cominations of the following lists?¶

In [115]:

x = [1,2,3]
y = [4,5,6]

In [116]:

for outer in x: 
    for inner in y:
        print(outer + inner)

Modify the for loop we just wrote to only print the sum of numbers if it is greater than 7¶

In [103]:

# your code here:

In [104]:

for outer in x: 
    for inner in y:
        number_sum = outer + inner
        if number_sum > 7: 
            print(number_sum)

8
8
9

Biology review about codons:¶

codons are three consecutive nucleotides that code for an amino acid¶

There are four special codons: one start, and three stop. Can you point out the start and stop codons?¶

Where do codons go in an RNA molecule?¶

Can we write a program to find the start codon in an RNA sequence?¶

What are the parts of the program we would need?¶

- Variable to store the RNA sequence¶

- A way to extract codons¶

- Variable to remember the position of the codon¶

- A way to check if the codon is a start codon¶

Try to write a program that will print the start codon position in this example sequence¶

hints: you'll need a for loop, `len()`, and `'range()`¶

In [105]:

rna_sequence = 'AUGUUUUUGAUACUUUUAAUUUCCUUACCAACGGCUUUUGCUGUUAUAGGAGAUUUAAAGUGUACUACAGUUUCCAUUAAUGAUGUUGACACUGGUGUUCCUUCUAUUAGCACUGAUACUGUCGAUGUUACUAAUGGUUUAGGUACUUAUUAUGUUUUAGAUCGUGUGUAUUUAAAUACUACGUUGUUGCUUAAUGGUUAUUACCCUACUUCAGGUUCUACAUAUCGUAAUAUGGCACUGAAGGGAACUUUACUAUUGAGCACACUGUGGUUUAAACCACCUUUUCUUUCUGAUUUUACUAAUGG'
#your code here

In [106]:

rna_length = len(rna_sequence)
last_codon_start = rna_length - 3
for codon_start in range(0,last_codon_start):
    codon_end = codon_start + 3
    current_codon = rna_sequence[codon_start:codon_end]
    if current_codon == 'AUG':
        print(codon_start)

Try to write a program that will find all stop codons in the same sequence¶

In [77]:

rna_sequence = 'AUGUUUUUGAUACUUUUAAUUUCCUUACCAACGGCUUUUGCUGUUAUAGGAGAUUUAAAGUGUACUACAGUUUCCAUUAAUGAUGUUGACACUGGUGUUCCUUCUAUUAGCACUGAUACUGUCGAUGUUACUAAUGGUUUAGGUACUUAUUAUGUUUUAGAUCGUGUGUAUUUAAAUACUACGUUGUUGCUUAAUGGUUAUUACCCUACUUCAGGUUCUACAUAUCGUAAUAUGGCACUGAAGGGAACUUUACUAUUGAGCACACUGUGGUUUAAACCACCUUUUCUUUCUGAUUUUACUAAUGG'
stop_codons = ['UGA','UAA','UAG']
#your code here
rna_length = len(rna_sequence)
last_codon_start = rna_length - 3
for codon_start in range(0,last_codon_start):
    codon_end = codon_start + 3
    current_codon = rna_sequence[codon_start:codon_end]
    if current_codon ==  stop_codons[0]:
        print(codon_start)
    elif current_codon ==  stop_codons[1]:
        print(codon_start)
    elif current_codon ==  stop_codons[2]:
        print(codon_start)

Challenge: Write a program that stores all start codon positions in the list `found_start_codons`¶

Also store all stop codons in the list `found_stop_codons`¶

In [107]:

# your code here
found_start_codons = []
found_stop_codons = []
rna_length = len(rna_sequence)
last_codon_start = rna_length - 3
for codon_start in range(0,last_codon_start):
    codon_end = codon_start + 3
    current_codon = rna_sequence[codon_start:codon_end]
    if current_codon ==  stop_codons[0]:
        found_stop_codons.append(codon_start)
    elif current_codon ==  stop_codons[1]:
        found_stop_codons.append(codon_start)
    elif current_codon ==  stop_codons[2]:
        found_stop_codons.append(codon_start)
    elif current_codon == 'AUG':
        found_start_codons.append(codon_start)

print(found_start_codons)
print(found_stop_codons)

[0, 79, 82, 124, 133, 151, 193, 231, 301]
[7, 16, 46, 55, 77, 80, 86, 107, 113, 131, 139, 157, 172, 191, 227, 238, 256, 272, 290, 299]

Lecture 2 - Input, conditionals and branching¶

Warm up¶

Raise the first element of the list below to the power of the fifth element¶

Is this number greater than 8 to the power of 10?¶

Append the answer to the end of the list¶

You can extract multiple parts of a list using a colon in your bracket [:]¶

For example, to extract the 1st through 3rd element of a list:¶

my_list[0:2]¶

In python, strings are just a list of characters so this works on strings as well!¶

Print the 2nd through 10th states below¶

len() gives you the length of a list or string¶

How long are the variables below?¶

How can we talk to our python script?¶

input() is a function that takes a text prompt and stores it as a string¶

The only argument for input() is a string that you want the prompt to be¶

to save what the user inputs, just save input to a variable¶

Try writing a program that takes a numerical input and prints the square of it¶

What is the most basic way to teach someone to do something?¶

Only give them two choices: Do this or do that¶

What are some examples of this?¶

Python thinks similarly: if the condition is true, do this thing¶

If statement structure¶

Python is sensitive to "whitespace"¶

Whitespace is a tab, or a space¶

where yourcondition is anything that returns a boolean (True/False)¶

Debugging practice¶

what happened here?¶

Does python think dogs are better than cats? whats going on??¶

strings are sorted lexicographically (aka: alphabetically) in python¶

d comes after c, which means d > c according to python¶

Write an if statement that checks if a is greater than b¶

If it is true, print "a is greater than b"¶

Else¶

The general structure of an if/else statement is:¶

Else does not take a conditional! it assumes the opposite of the if conditional¶

Lets try an else statement¶

in this case, "u" is lexicographically (alphabetically) after "g"¶

to python, this means "unix" is less than "gui" is False¶

Debugging practice¶

What went wrong here?¶

Write an if statement that checks if a is greater than b¶

if it is true, print a is greater than b¶

if it is false, print b is greater than a¶

Else and elif¶

Write a program that take a number as an input and checks if it is between 28 and 30.¶

If it is less than 28, print "your number less than 28".¶

If it is greater than 30, print "your number is greater than 30".¶

If the number is 29, print "thats a nice number"¶

for loops are similar between bash and python¶

Recall what a for loop is:¶

for this thing in my list of stuff, do this¶

for loop structure in python¶

note that there is no do/done/semicolon!¶

Write a for loop to print each letter in the first five letters of the alphabet¶

Challenge:¶

What would the last line of the following code return?¶

Making lists quickly¶

Python has a function range() that will give you the numbers between the two arguments, excluding the last number¶

Write a function that sums all of the numbers between 1 and 100¶

Can we write a function that prints the sums of all cominations of the following lists?¶

Modify the for loop we just wrote to only print the sum of numbers if it is greater than 7¶

Biology review about codons:¶

codons are three consecutive nucleotides that code for an amino acid¶

There are four special codons: one start, and three stop. Can you point out the start and stop codons?¶

Where do codons go in an RNA molecule?¶

Can we write a program to find the start codon in an RNA sequence?¶

What are the parts of the program we would need?¶

- Variable to store the RNA sequence¶

- A way to extract codons¶

- Variable to remember the position of the codon¶

- A way to check if the codon is a start codon¶

Try to write a program that will print the start codon position in this example sequence¶

hints: you'll need a for loop, len(), and 'range()¶

Try to write a program that will find all stop codons in the same sequence¶

Challenge: Write a program that stores all start codon positions in the list found_start_codons¶

Also store all stop codons in the list found_stop_codons¶

You can extract multiple parts of a list using a colon in your bracket `[:]`¶

`my_list[0:2]`¶

`len()` gives you the length of a list or string¶

`input()` is a function that takes a text prompt and stores it as a string¶

The only argument for `input()` is a string that you want the prompt to be¶

where `yourcondition` is anything that returns a boolean (True/False)¶

Python has a function `range()` that will give you the numbers between the two arguments, excluding the last number¶

hints: you'll need a for loop, `len()`, and `'range()`¶

Challenge: Write a program that stores all start codon positions in the list `found_start_codons`¶

Also store all stop codons in the list `found_stop_codons`¶